Water lettuce (Pistia stratiotes): An aquatic member of the arum family (Araceae) with characteristics similar to the duckweed genus Spirodela. For decades, Pistia was thought to be a possible ancester to the duckweeds; however, phylogenetic studies using chloroplast DNA indicate that Pistia cannot be considered a morphological intermediate between duckweeds and other arums. Note the small white spathe (red arrow) surrounding the anthers at the apex of a reduced spadix.   Cladogram From Cabrera et al. (2008)

Cladogram: A diagram or phylogenetic tree that shows ancestral monophyletic relationships between species. A group of species connected by a single branch or clade have a common ancestor and are termed monophyletic. Two sister clades with the same common ancestor are also termed monophyletic. Cladograms are generated by computers using a program such as PAUP (available for PCs, Mac and Linux). Morphological data was originally used to create cladograms, but most modern taxonomists now use DNA sequence data.

Monophyletic: A taxonomic group that represents a single branch (clade) in a cladogram, and having a common ancestor. For example, all birds and reptiles are thought to have descended from a single common ancestor and are monophyletic. Humans (Homo) and chimpanzees (Pan) are also monophyletic. Each of the three genera (Araucaria, Agathis and Wollemia) in the plant family Araucariaceae are monophyletc, although Wollemia is the most primitive. The araucaria and podocarpus families (Podocarpaceae), which have their greatest diversity in the southern hemisphere, are also monophyletic and occur on sister clades. These two families have a common ancestor that lived in the southern supercontinent called Gondwanaland.

Paraphyletic: If the grouping includes a common ancestor plus some, but not all, decendants it is paraphyletic. Modern reptiles is a grouping that contains a common ancestor, but does not contain all descendants of that ancestor (i.e. birds are excluded).

Polyphyletic: If the grouping includes two or more separate monophyletic or paraphyletic groups, each with a separate common ancestor, it is polyphyletic. The common ancestor of all members is not itself a member of the group. A grouping of warm-blooded animals would include birds and mammals and is called polyphyletic because the members of this grouping do not include the most recent common ancestor.

Conserved Genes: Depending on the desired phylogenetic level, conserved and non-conserved genes are used. Highly conserved genes code for structural products, regulatory proteins, and transfer RNAs. Their sequences are very stable because changes in the DNA (mutations) are usually detrimental. Genes that are not highly conserved are subject to mutations. In DNA comparisons between species, non-coding spacer genes are sometimes used. Since spacer genes are not under selection, they may contain different DNA sequences useful in comparing species. For example, phylogenetic studies and cladograms for the duckweed family were based on sequences of the trnL-trnF intergenic spacer region of the chloroplast genome. This spacer region is non-coding DNA between the trnL and trnF loci. Different genes within the nucleus and cytoplasmic organelles (chloroplast and mitochondria) can be used to construct phylogenetic trees called cladograms. One gene in the nucleolus codes for the smaller subunit of the ribosome. The gene is called SSU rDNA or small subunit ribosomal DNA. Base sequences from this gene are sometimes used to compare taxa at the species level. Chloroplast DNA, including the protein-coding rbcL gene, is often used at the family level to show the relationships between genera and species within the family. Introns are also used to construct family trees. Introns are sections of messenger RNA that are removed prior to translation at the ribosome. Parsimony: The least complex explanation for an observation. In other words, do not generate a hypothesis any more complex than is demanded by the data. In systematics, maximum parsimony is a cladistic "optimality criterion." Under maximum parsimony, the preferred phylogenetic tree is the tree that requires the smallest number of evolutionary changes. The principle of parsimony is stated in Occam's Razor (Ockham's Razor). It is attributed to the 14th century English logician, theologian and Fransiscan friar William of Ochham. The popular computer program used to generate phylogenetic trees from DNA sequence data is called PAUP: Phylogenetic Analysis Using Parsimony.

PAUP File Formats: freqpars GCG Hennig86 MEGA NBRF & PIR Phylip 3.x Simple Text   (See example to right:) Tab Delimited Text

Simple Text   species1   GCAGTCTGAACGCACGAAGCCGACTGGTGACGAACGCACC   species2   GTAATTACCGCTCTTCCCCTGCAAAGTGGCAGAAGTGACA   species3   TTAGTGTCAGCATGCAACACAACGCGGATCGTAATACAAC   species4   TTGTGTCGAGTGGCTTTATACAGGTGTGTGTACTCCTGAA   species5   AAAGGGCGTTATTACGGTAGGGGCTGAATCGAGTTGTAGC   species6   GGGGTACAGCGCCATAGCGCAAAAAGGAAGTGGCAGTAAA

Boot Strap Value: This definition is greatly oversimplified. Cladograms are computer-generated multiple times, and they don't always come out the same. The term "bootstrapping" refers to a cladogram or specifically a clade (branch of a phylogenetic tree) that comes out the same way out of a total number of times. For example, if one thousand clades are generated randomly and the same pattern comes out 900 times, this clade would have a bootstrap value of 90 percent. The original clade consisting of Agapanthus (lily of the Nile) and Amaryllidaceae (amaryllis family) had only a 63 percent bootstrap value. It was rejected by the Angiosperm Phylogeny Group (APG) and replaced by a different clade with a higher bootstrap value. The genus Agapanthus is now placed in its own family the Agapanthaceae and shares a common (monophyletic) ancestry with the Amaryllidaceae and Alliaceae (onion family). The latter family was once placed in the Amaryllidaceae.

Comparison Of Boot Strap Value Used In Cladograms With The Generation Of Crossword Puzzles: I.e. Using Same Down & Across Choices. Computer generates same crossword puzzle 100 times, but grid patterns are not all the same. Out of total of 100, the left pattern comes up 85 times. The Bootstrap Value would be 85/100 or 85 percent.   Go To Wayne's Word     Crossword Puzzles

Restriction Enzyme: An enzyme that cuts double-stranded or single-stranded DNA at specific recognition nucleotide sequences known as restriction sites. These enzymes occur naturally in bacteria plasmid DNA and are thought to have evolved as a defence mechanism against viruses. Many are commercially available for DNA research laboratories, particularly for the isolation of specific genes or intergenic spacers used in DNA comparisons between different species and genera.

Indel: A mutation that includes an insertion or deletion resulting in a gain or loss of nucleotides. A microindel is a gain or loss of 1 to 50 nucleotides. In coding regions of the genome, unless the length of an indel is a multiple of three nucleotides, they produce a frame-shift mutation. Indels can be contrasted with a point mutation: An indel inserts or deletes nucleotides from a sequence; a point mutation is a substitution that replaces one of the nucleotides.

A. Tecate cypress (H. forbesii), B. Sargent cypress (H. sargentii), C. Piute cypress (H. nevadensis), D. Cuyamaca cypress (H. stephensonii), E. Santa Cruz cypress (H. abramsiana, F. Monterey cypress (H. macrocarpa), G. Gowen cypress (H. goveniana), H. Mendocino cypress (H. pygmaea), I. Macnab cypress (H. macnabiana), J. Modoc cypress (H. bakeri), K. Smooth-bark Arizona cypress (H. glabra), L. Rough-bark Arizona cypress (H. arizonica), M. San Pedro Martir cypress (H. montana), N. Mexican cypress (H. lusitanica), O. Italian cypress (C. sempervirens), P. Sahara cypress (C. dupreziana), Q. Kashmir cypress (C. cashmeriana), R. Mourning cypress (C. funebris), S. Port Orford cedar (C. lawsoniana), T. Alaska cedar (C. nootkatensis), U. Leyland cypress Callitropsis x leylandii). Note: The Port Orford cedar (S) remains in the genus Chamaecyparis, while the and Alaska cedar (T) is now placed in the genus Callitropsis, while the Leyland cypress (U) becomes Callitropsis x leylandii. Callitropsis may be rejected by 2012 Botanical Congress and possibly changed to Hesperocyparis. Groupings of species, such as Hesperocyparis (Callitropsis), Chamaecyparis, Juniperus and Old World Cupressus represent separate branches (clades) in computer-generated phylogenetic trees.

Cladistic analysis of chloroplast DNA has resulted in some major changes in the phylogeny of angiosperms. According to Plant Systematics: A Phylogenetic Approach by Judd, et al. (2008), members of the Nolinaceae and Dracaenaceae are now included within the Ruscaceae. The latter family also includes Aspidistra (cast iron plant), Liriope (border grass) and Ophiopogon (mondo grass). Familiar genera such as Hyacinthus (hyacinth), Aspholelus (asphodel), Asparagus (asparagus), Allium (onion) and Iris (iris) belong to their own separate families, the Hyacinthaceae, Asphodelaceae, Asparagaceae, Alliaceae and Iridaceae. The latter family (Iridaceae) also includes the commonly cultivated Watsonia, Moraea (butterfly lily), Freesia (freesia), Sisyrinchium (blue-eyed grass), Crocus and Gladiolus. Amaryllis (naked lady) still belongs to the Amaryllidaceae and also includes many genera that were once placed in the Liliaceae, including Crinum, Hippeastrum (amaryllis), Hymenocallis (spider lily), Haemanthus (blood lily), and Narcissus (daffodil). Agapanthus (lily of-the-Nile), Hemerocallis (day lily) and Colchicum (autumn crocus) belong to their own families, the Agapanthaceae, Hemerocallidaceae and Colchicaceae. Lilium (lily), Tulipa (tulip), Calochortus (Mariposa lily) and Fritillaria (chocolate lily) are still included in the lily family (Liliaceae). Chlorogalum (soap lily) is now placed in the agave family (Agavaceae) with Agave, Yucca, Hesperocallis (desert lily) and Camassia (camas). Death camas and star lilies (Zigadenus) are now placed in the Melanthiaceae along with Veratrum (corn lily), Trillium (trillium) and Xerophyllum (bear grass) . The cormous genera Brodiaea (Brodiaea), Dichelostemma (blue dick), Bloomeria (golden stars) and Triteleia are now in the family Themidaceae. The genus Aloe, formerly of the Liliaceae, is now placed in the family Asphodelaceae, along with Kniphofia (red hot poker) and Haworthia. These significant changes in plant classification will be adopted by the new revised Jepson Flora of California.

From a purely morphological point of view, one of the most astonishing changes is the placement of members of the Nolinaceae and Dracaenaceae into the Ruscaceae. The type genus Ruscus includes a low-growing Eurasian shrub called butcher's broom (R. aculeata) that bears no resemblance to Nolina, Dracaena & Beaucarnea. See the following image:

Computer generated monophyletic clades based on chloroplast DNA have resulted in drastic changes to the Scrophulariaceae. Plantago, Penstemon, Veronica, Linaria, Antirrhinum, Keckiella, & Digitalis are now placed in the Plantaginaceae. Mimulus with its thigmotropic stigma is placed in the Phrymaceae. Traditional genera retained in the Scropulariaceae include Verbascum and Scrophularia. Other genera placed in the Scrophulariaceae include Buddleja and Myoporum. Indian paintbrush (Castilleja), Indian warrior (Pedicularis), and owl's clover (Orthocarpus) are placed in the parasitic family Orobanchaceae with the broomrapes (Orobanche). Other closely-related families representing separate clades are the Paulowniaceae, Lentibulariaceae, Acanthaceae and Bignoniaceae. Members of the Martyniaceae (Proboscidea, Martynia & Ibicella) are included in the Pedaliaceae with Uncarina, Harpagophytum & Sesamum.

Judd, W.S., Campbell, C.S., Kellogg, E.A., Stevens, P.F., and M.J. Donaghue. 2008. Plant Systematics: A Phylogenetic Approach       (Third Edition). Sinauer Associates, Inc., Sunderland, Massachusetts. 611 p.

The common potato (Solanum tuberosum) is an autotetraploid species with a sporophyte chromosome number of 48 (4n=48). The normal sporophyte diploid number for the genus Solanum is 24. Eggplant (S. melongena) belongs to the genus Solanum and tomatoes (Lycopersicon esculentum) are closely related to the potato. Common potatoes (S. tuberosum) consist of two subspecies or groups, ssp. tuberosum ( "Chilotanum Group") and ssp. andigena ("Andigenum Group"). Older references state that potatoes taken to Europe in the sixteenth century all belonged to the andigena subspecies or "Andigenum Group" which was widely cultivated in the Andean highlands of Bolivia, Peru and northern Argentina. The origin of this tetraploid subspecies is controversial, but some authorities believe it resulted from hybridization between a diploid Andean species (S. stenotomum) and another diploid species (possibly S. sparsipilum), followed by autopolyploidy. The precise origin of the subspecies tuberosum or "Chilotanum Group" native to Chile is even more controversial, possibly derived from the subspecies andigena or the hybridization of subspecies andigena with yet another unknown Andean species. According to Mercedes Ames and David Spooner, the single Andigenum origin of the modern "European" potato (with cultivars grown worldwide) is not supported by plastid DNA studies from historical herbarium specimens. Their research points to a Chilotanum origin traced to a landrace indigenous to Chiloé, largest island in the Chiloé Archipelago off the coast of Chile. In addition, this research shows the critical importance of herbarium specimens in investigating historical origins of crop plants.

  Juzepczuk, S.W., and S.M. Bukasov. 1929. "A Contribution to the Question of the Origin of the Potato." TrVses Azeda Genet Selek 3: 593-611 (in Russian, English summary).

  Ames, Mercedes and David D. Spooner. 2008. "DNA From Herbarium Specimens Settles a Controversy About Origins of the European Potato." American Journal of Botany 95 (2): 252-257.

The Human Genome Project is a worldwide endeavor to map the DNA base sequence of every gene in the human genome. As of February 2001, the total number of functional genes is considerably less than expected, about 30,000 genes per cell compared with previous estimates of 100,000 genes. It has been estimated that a human somatic cell contains about 5 billion base pairs. If the average gene contains 1500 bases, then 30,000 functional genes is only about one percent of the total DNA per cell. Although there is an estimated six feet of DNA per human cell, only a small fraction of this amount consititutes the actual protein-coding genes.

Much of the DNA of humans is referred to as "variable number tandem repeats" (VNTRs) rather than specific protein-coding genes. The greatest variation in the DNA of two individuals is not in the protein-coding genes, but in the nonprotein-coding sections of their DNA. Natural selection has resulted in some time-tested DNA sequences called genes which are identical in normal individuals. The exact number and order of amino acids in protein molecules are determined by the DNA base sequences of genes, and genetic mutations are essentially "misspelled " genes. Genetic mutations, including variations in the base sequences of vital genes, may be fatal if they fail to code for a vital enzyme. For example, the dominant gene for hemoglobin is a time-tested sequence of DNA bases that is essential for the production of this life-giving pigment. Hemoglobin is a quaternary protein composed of four polypeptides and 484 amino acids. The substitution of valine for glutamic acid (glutamate) in the beta polypeptide changes the oxygen-carrying potential of this vital blood cell pigment, and is the biochemical explanation for the genetic disease called sickle-cell anemia. Natural selection does not limit variability in nonprotein-coding sections since these regions of DNA are not involved in the survival or reproductive success of individuals. Consequently, the DNA used to show variation between individuals comes from the nonprotein-coding sections called VNTRs. DNA sections unique to each individual are separated in a process called gel electrophoresis using a gel box.

DNA is negatively charged and migrates to the positive pole of a gel box containing agarose gel. The porous gel is made from agar, a polysaccharide extract from red algae (division Rhodophyta). Precise amounts of the DNA solutions being compared (containing RFLPs) are transferred to indentations or wells in the gel using a micropipetter. Gel patterns are similar to chromatographs and the process of separating sections of DNA is called gel electrophoresis. Restriction enzymes cut DNA into sections or fragments called restriction fragment length polymorphisms (RFLPs). Restriction enzymes are analogous to molecular scissors, cutting the DNA at specific base sequences called restriction sites. These enzymes were originally discovered in bacteria, a remarkable defensive mechanism that enables bacteria to cleave invading viral DNA, thus rendering it harmless. One restriction enzyme can cut DNA into more than 700,000 pieces. For example, a specific restriction enzyme (Hind3) cuts the DNA between adenine and adenine on the base sequence A|AGCTT. One DNA strand runs in the 5' to 3' direction, while the complementary strand runs in the 3' to 5' direction. The complementery strand is also cut between adenine and adenine TTCGA|A. Another restriction enzyme (EcoR2) cuts the DNA between guanine and adenine on the base sequence G|AATTC. The complementary strand is also cut between adenine and guanine CTTAA|G. The exact base sequence and length of a DNA fragment varies with different individuals. Every person has fragments with different lengths and unique base patterns, such as AGCTT and AATTC. The following table summarizes how the restriction enzymes Hind3 and EcoR2 cut specific base sequences at specific retriction sites.

Because of different numbers of purine and pyrimidine bases, the DNA fragments (RFLPs) have different molecular weights and migrate to different positions in the gel box. The fragments are displayed as bands in the gel, similar to the separation of different molecules in chromatography. Gel electrophoresis can separate DNA molecules that differ in length by only a few nucleotides. Banding patterns can be enhanced when viewed on a light box or under ultraviolet light. They may also be photographed. The specific banding pattern of an individual depends on the precise fragments that are separated on a gel layer. Because everyone has slightly different banding patterns, gel electrophoresis is used to determine the precise DNA fingerprint of an individual. In a human DNA fingerprint, thousands of bands from the evidence (crime scene) and suspect are carefully compared in order to show a percent similarity. DNA fragments (RFLPs) can also be anayzed from plants, algae and fungi. In order to run a sufficient quantity of fragments to produce a visible banding pattern, the DNA is amplified using the PCR technique (polymerase chain reaction) described below.

Gender verification in the Olympic Games now employs sophisticated DNA testing rather than counting Barr bodies within the nuclei of cells. The test is designed to detect the presence of the SRY gene (sex region Y chromosome), a region of DNA on the short arm of the Y chromosome responsible for masculinization of the fetus. Cells from the buccal mucosa (squamous epithelial cells), often called "cheek cells" in general biology classes, are obtained by gently scraping the inside of the mouth with a toothpick. The DNA in the nuclei of these cells is amplified using the PCR technique (polymerase chain reaction). If present, the SRY gene will show up as a unique banding pattern by electrophoresis on agar gels.

In addition to DNA fingerprinting based on banding patterns from gel electrophoresis, scientists can also determine the exact sequence of bases (adenine, thymine, guanine and cytosine) in a DNA fragment or a complete gene. An instrument called an automated DNA sequencer analyzes the DNA sample and produces a printout with peaks and valleys representing all the four nucleotides (A, T, C and G). Special fluorescent nucleotides amplified with PCR produce color-coded printouts of the four bases. Modified nucleotides used in the PCR replication contain an attached molecule that fluoresces a particular color when it passes through a laser beam. Each DNA fragment (band) extracted through gel electrophoresis can be sequenced to show the exact order of bases. Entire genes are also sequenced, including DNA from chloroplasts, mitochondria, introns, and the genes that translate for large and small subunits of ribosomes.

DNA sequencing is a valuable tool in taxonomic studies of species within families and the phylogenetic relationships of larger categories of animals and plants. One of the most interesting studies of human genes has resulted in a theory that traces the mitochondrial DNA of humans to an ancestral woman who lived in Africa about 100,000 years ago. Since mitochondria are only passed on through the egg, the genes are relatively stable from generation to generation, compared with nuclear DNA which may be altered during meiosis and sexual reproduction. Chromosomal genes are recombined during crossing over, and reshuffled during random assortment of the chromosomes and random combination of the gametes.

All all of these remarkable methods of DNA analysis would be impossible without the ability to amplify DNA with the polymerase chain reaction. PCR is an extremely valuable technique in forensic criminology involving rape, murder and disputed parentage. DNA can be identified from small samples of blood, saliva, skin, hair follicles and semen. In fact, the acronym PCR became well-known during the O.J. Simpson trial. When amplifying genes using PCR, it is imperative that the sample not be contaminated with any foreign DNA, otherwise the foreign genes may be inadvertently amplified. For example, in a research paper the genes of a spruce tree were sequenced, only to find out later that the actual DNA came from an internal parasitic fungus that was living within the spruce sample!

In order to amplify a gene using PCR, the DNA from an organism must be extracted and placed in a test tube. There are several "cookbook method" procedures for extracting nuclear DNA from the nucleus and nucleolus, and cytoplasmic DNA from cellular organelles, including the chloroplast and mitochondria. Total genomic DNA includes the nucleus and cytoplasmic organelles. The following procedure was used to isolate genomic DNA from a duckweed (Lemna minuta). Although members of the duckweed family (Lemnaceae) are commonly polyploid, they still have one genome composed of multiple sets of chromosomes.

DNA can easily be extracted from dried split peas (or other vegetables) and a few ordinary household chemicals, including liquid detergent, meat tenderizer and rubbing alcohol (isopropyl alcohol). The procedure is illustrated at the web site of the Genetic Science Learning Center, University Of Utah:

A thick, pea-cell soup is made by grinding up 100 ml of dried split peas in a blender with 200 ml water, and then filtering through a fine-mesh strainer into a measuring cup. Two tablespoons of liquid detergent are added and the soup is allowed to sit for 10 minutes. Next the soup is placed in test tubes (1/3 full) or small glass containers. There is sufficient pea soup to fill a dozen or more small test tubes up to 1/3 full. Then a pinch of meat tenderizer containing papain or bromelain enzymes is added to each test tube and the mixture is gently (briefly) stirred with a slender rod such as a wooden skewer. Finally, rubbing alcohol (70-90% isopropyl alcohol) is slowly pored into each test tube (2/3 full) so that it forms a layer on top of the pea mixture. DNA rises into the alcohol layer like a cottony mass of threads and can be rolled onto a wooden stick or stirring rod. By adding isopropanol (which is infinitely soluble in the aqueous layer but not the DNA), the resultant solution forces the DNA out of solution as a solid. I.e. when the concentration of alcohol/water solution is such that the DNA is no longer soluble, the DNA precipitates out of solution. If you don't see any DNA, let the test tube sit for 15 minutes to an hour. A cottony mass should be visible in the alcohol layer, just above the thick pea soup layer. This genomic DNA comes from all the cells of the ground up peas. Unless it is cut by restriction enzymes into sections (RFLPs), it is much too long and stringy to migrate through the pores of agarose gel during electrophoresis.

An interesting fact about enzymes is that Jello® is not recommended with the following fresh or frozen fruits and roots: pineapple (Bromeliaceae: Ananas comosus), papaya (Caricaceae: Carica papaya), figs (Moraceae: Ficus carica), guava (Myrtaceae: Psidium guajava), kiwi (Actinidiaceae: Actinidia chinensis), and ginger root (Zingiberaceae: Zingiber officinale). All of these plants contain proteolytic (protein digesting) enzymes which prevent the gelatin from setting (changing into a gel state) as it cools. Some of these protease enzymes have been used medicinally and as meat tenderizers, such as ficin from figs (Ficus), papain from papaya (Carica), and bromelain from pineapples (Ananas). Try adding some pineapple juice to milk. The milk protein begins to coagulate and degrade as it reacts with the bromelain. Pineapple juice will also remove the gelatin-emulsion surface on black & white photographic film. [The emulsion surface contains light sensitive silver halides in a gelatin that is rinsed away during processing. The silver that remains on the film emulsion reveals the negative image from which the photographic print is created.] In French Polynesia, the ficin-rich sap from a native banyan fig is used to kill parasitic worms and to treat worts and skin cancers. Ficin also breaks down the female pollinator wasp inside wasp-pollinated Calimyrna figs grown in California's Central Valley. When you eat one of these delicious figs, you won't find the wasp inside that was responsible for the seed formation and superior nutty flavor.

DNA polymerase and a mixture of all four nucleotides are added to a test tube containing the extracted DNA sample. When the double-stranded parental (template) DNA is heated to 95 degrees Celsius, the individual strands unwind and separate from each other. The objective is to replicate the section of each strand containing the target gene using the enzyme DNA polymerase. Each single parental strand of DNA has the remarkable property of rebuilding the missing complementary strand as nucleotides attach in the 5 prime (5') to 3 prime (3') direction. Each newly-formed complementary strand (one for each parental strand) is called a "daughter strand."

In order for DNA polymerase to find the start of a specific target gene in each section of DNA, a short segment of DNA called a primer must be attached (annealed) to each "mother" DNA strand upstream (toward 3' end) from each gene. The primer does not overlap the target gene, because it is complementary to the base sequence that appears just before the gene on the mother strand of DNA. The complementary "daughter" strand is produced in the 5' to 3' direction. Primers contain about 20 bases and they have been synthesized for many of the genes that are commonly amplified using the PCR technique. They may be purchased from biotechnology supply companies. The primer for a specific gene is added to the mixture of single-stranded DNA after it has cooled down to 52-54^o C (126-129^o F).

As the double-stranded, parental (template) DNA ladder unzips and nucleotides attach to each of the two single parental strands, something very interesting happens. One daughter strand, called the "leading strand," forms continuously as nucleotides attach in the 5' to 3' direction. But in the other daughter strand, called the "lagging strand," the nucleotides attach in discontinuous sections. These sections are called Okazaki fragments, named after the Japanese scientist Reiji Okazaki who discovered them. Since the lagging strand is complementary to the leading strand, its 3' end is opposite the leading strand's 5' end, and vice versa. The only way this strand can lengthen in the 5' to 3' direction as the parental DNA molecule unzips, is is for it to grow in sections or fragments. This remarkable discovery is shown in the following illustration.

The structure and function of DNA are certainly two of the most significant discoveries that have revolutionized the science of biology. Even though DNA appears to be a perfect storage molecule for genetic information, it has a serious replication problem. Chromosomes of eukaryotic cells are composed of linear DNA. In order for cell division to take place, the DNA molecule must replicate. In other words, the single chromosome must become a doubled chromosome composed of two chromatids. The problem is that each time DNA replicates the new molecules get slightly shorter. After a number of consecutive divisions, this degradation could result is serious gene loss at the ends of the chromosomes. Both Alexey Olovnikov and James Watson independently described this phenomenon called "end replication problem" in the early 1970s. In fact, Olovnikov's "A Theory of Marginotomy" predicted that the loss of terminal sequences resulting from end replication problem would lead to senescence (Olovnikov, 1973). [James Watson and Francis Crick discovered the structure of DNA in 1953 and received the Nobel Prize in Medicine in 1962.]

To cope with the devastating end problem replication problem, eukaryotic cells have evolved protective "caps" on the ends of chromosomes called telomeres. For their discovery of how chromosomes are protected by telomeres and the enzyme telomerase, Elizabeth Blackburn, Jack Szostak and Carol Greider were awarded the Nobel Prize in Medicine in 2009. With their ingenious genetic research and meticulous biochemical studies, they not only solved a fundamental problem in biology but also opened a new field of research and initiated the development of potential therapies against the aging process and cancer. It should be noted here that more than 60 years earlier, Barbara McClintock was studying telomeres in corn. In the early 1940s she turned her attention to the study of transposable elements (transposons) in corn, another remarkable genetic phenomenon with important medical implications in people. For her lifelong research on transposons, she received the Nobel Prize in Medicine in 1983.

Telomeres are repetitive strands of DNA (sequences of repetitive bases) at the terminal ends of linear chromosomes. They play an essential role in maintaining the integrity of the chromosome by protecting it from degradation and from end-to-end fusion with other chromosomes. Telomeres are essentially protective "end caps" of non-coding DNA at the extreme ends of chromosomes. Telomeres have been metaphorically compared with the tips of shoelaces that keep the laces from unraveling. Each time a cell divides, the telomeres lose a small amount of DNA. Eventually, when all of the telomere DNA is gone, the cell can no longer divide and dies. End replication problem is not an issue in prokaryotic cells because they have circular DNA molecules without ends.

The number of times a population of normal cells can divide is called the Hayflick limit, named after its discoverer Leonard Hayflick. In 1961, Hayflick demonstrated that normal human fetal cells in a culture divide between 40 and 60 times. It is now clear that cell division occurs until the telomeres reach a critical length. An estimated length for human telomeres ranges from 8,000 base pairs at birth to 3,000 as people age, and as low as 1,500 in elderly people. Starting with 8,000 base pairs, a loss of 100 to 200 with each division would completely erode away the telomeres in 40 to 80 divisions.

Chromosome duplication starts with the unzipping of the double stranded DNA into two strands (mother strand #1 & mother strand #2). These complementary mother strands serve as templates to build two DNA molecules. An RNA primer attaches to the 3' end of mother strand #1, thus giving DNA polymerase a place to start. The primer attaches just before the initial attachment of DNA polymerase. DNA polymerase moves in the 3' to 5' direction along mother strand #1, adding nucleotides to form a continuous complementary daughter strand of DNA the entire length of the mother strand #1 template. This complementary strand is called the "leading strand" and it is synthesized in the 5' to 3' direction. [5' and 3' refer to specific carbon atoms of deoxyribose sugar in DNA building blocks called nucleotides.] When 5' and 3' directions are mentioned, it is important to specify whether you are referring to the mother strand or the complementary daughter strand.

As the original mother DNA unzips, DNA polymerase cannot attach to the top of mother strand #2 at the 5' position (top right in following diagram). Even if it could attach to the top of mother strand #2 at the 5' position, it could not move down the mother strand and synthesize a daughter strand in the 3' to 5' direction. Therefore, DNA polymerase attaches farther down on mother strand #2 and produces a series of DNA sections in the 5' to 3' direction. These sections are named "Okazaki fragments" after the Japanese scientist Reiji Okazaki who discovered them. The sections collectively form a daughter strand called the "lagging strand" to the top of mother strand #2. This is nicely explained by R. Ohki, T. Tsurimoto and F. Ishikawa (Molecular and Cellular Biology Vol. 21, 2001). Short RNA primers must attach ahead of each DNA section in order to form a starting point for DNA polymerase.

There is a problem at the 3' end of mother strand #2. When the last RNA primer reaches this end, there is no more DNA template for it to keep ahead of DNA polymerase. The last primer attaches to the 3' end, but DNA polymerase cannot add the last section of the lagging strand, leaving a gap where the primer was attached. Therefore, the 5' end of each newly synthesized lagging strand is cut short. About 100 base pairs are shaved off with each round of replication, thus shortening the telomere. In the following diagram, mother strand #2 has a gap at the 5' end of the newly formed lagging strand.

Telomeres can be restored by the enzyme telomerase. This enzyme lengthens telomeres in germ cells (cells that produce eggs and sperm), thus restoring telomeres to their maximum length in the zygote. It is also present in other cells that must continually divide, including bone marrow stem cells that produce large numbers of generations of red blood cells necessary to sustain life, the epithelium of skin, and cells lining the intestine. Telomerase is generally not active in normal somatic cells. This enzyme adds noncoding DNA sequence repeats TTAGGG in vertebrates to the 3' end of DNA strands in the telomere region of eukaryotic chromosomes. The presence of active telomerase in cancer cells may be useful in the diagnosis and treatment of some cancers with telomerase inhibitors.

The following paragraph comes from Science and Technology (9 November 2007): Sharks have telomerase in all of their cells. Their telomeres don't shorten and sharks do not have a genetically programmed life span like humans. In fact, sharks keep growing throughout their life. The limit to their life span is the fact that they must keep moving in order to circulate air through their gills for the uptake of oxygen. Sharks are exceptionally genetically stable, having changed very little in hundreds of millions of years. In addition, sharks rarely get cancer.

Telomeres and telomerase also occur in plant cells. Plant telomere biology is summarized by T.D. McKnight and D.E. Shippen in The Plant Cell Vol. 16: 794-803 (2004). In most flowering plants, telomeres consists of the DNA base repeats TTTAGGG. Like the somatic cells of animals, there is little or no active telomerase in vegetative tissue, although it is reactivated during flowering, probably to ensure that gametes and embryos inherit telomeres restored to their maximum length. Like cancer cells in in animals, telomerase is fully functional in cells of plant tissue cultures, as might be expected for cells with an unlimited capacity for proliferation. The monocot order Asparagales that contains about 27,000 species (roughly10 percent of all angiosperms) has 6-base repeats of TTAGGG, the same sequence found in mammalian telomeres. This order includes many familiar plant families, such as orchids, iris, amaryllis, agave, onion and asparagus. Since plants and mammals evolved into multicellular organisms along completely separate pathways, this appears to be yet another example of parallel evolution (homoplasy).

Telomeres do not prevent the shortening of DNA, they just postpone the erosion process. The telomere shortening mechanism normally limits cells to a fixed number of divisions. Eventually, when all of the telomere is gone, the cell can no longer divide, thus terminating the cell cycle. Most cancer's are the result of "immortal" cells which have evaded programmed cellular death due to erosion of telomeres. Chromosomes of malignant cells usually do not lose their telomeres, thus resulting in uncontrolled cell division. Animal studies suggest that telomere length may be related to the aging process on the cellular level and the life span of animals. There are even studies suggesting that regular exercise and stress reduction may help to minimize telomere erosion. In fact, a study published in the May 3, 2005 issue of the American Heart Association journal Circulation found that weight gain and increased insulin resistance were correlated with greater telomere shortening over time.

It is interesting to speculate on the origin of telomeres. If another version of DNA polymerase existed that attached to the 5' end of mother strand #2 and added nucleotides in the 3' to 5' direction, then theoretically a continuous strand could be synthesized to the end of the mother strand template without the end replication problem. This theoretical version has never been found and therefore telomeres are essential to prevent the gradual shortening of DNA and erosion of genes. Why is there only one form of DNA polymerase that synthesizes daughter strands in the 5' to 3' direction? This is like asking why living systems only have L-form (left handed) amino acids and D-form (right handed) sugars. Did the evolution of telomeres solve a replication problem inherent in the original DNA, or were telomeres present in the original DNA of the first eukaryotic cells?

When I first wrote this section about end replication problem, I concluded that it was a defect in DNA that literally shortened the life of a cell by limiting the number of divisions. Telomeres serve as mitotic time clocks that prolong life by a certain number of consecutive erosions. However, there is another side to this story where limiting the life span of organisms could actually be beneficial. In a rapidly changing environment, survival of a species depends on genetic variability through DNA mutations and the ability to pass these genes on to future generations. A species with exceedingly long generation times may not be able to compete because adaptive mutations can't keep up with environmental changes; however, longer generation spans could also slow population growth as long as fecundity (number of offspring per female) remains constant. To an individual, immortality may seem good; however, this may not be good for the species. This logic is mentioned in Star Trek 2: "The Wrath of Khan" when Spock said: "The good of the many outweighs the good of the few, or the one." Actually, this logic is mentioned two thousand years earlier in John 11:49-50. Of course, one caveat to the benefit of end replication loss is the shark, which apparently has active telomerase in all of its cells and telomeres lengths that don't decline significantly with age. Sharks (class Chondrichthyes) are a very successful group and they have been around for more than 200 million years. In fact, some species have age estimations of 100 years or more. Undoubtedly, environmental changes in the ocean have not been as rampant as on land.

The DNA mixture is heated to 72^o C (162^o F) and DNA polymerase recognizes the primer annealed to each strand and proceeds to synthesize the complementary strand all the way down the gene. Nucleotides attach along the gene from all the adenines, thymines, cytosines and guanines that are already in the mixture. Now the mixture contains two identical copies of the gene (two complete DNA ladders). DNA polymerase from the bacterium Thermus aquaticus (called TAQ polymerase) is used for the reaction because it is immune to the high temperatures. Unlike most protein enzymes that are destroyed at temperatures above 40^o C (104^o F), DNA polymerase from Thermus aquaticus can survive the 72^o C of the reaction. In fact, this bacterium normally lives in hot springs and can survive temperatures approaching the boiling point of water.

Boiling hot springs in Yellowstone National Park are colored by colonies of thermophilic cyanobacteria, eubacteria and archaebacteria. Orange-colored cyanobacteria generally occur in water that has cooled below 73^o C (163^o F). The green chlorophylls in

these photosynthetic bacteria are masked by orange carotenoid pigments. Like the bright red halobacteria of salt lakes, carotenoids protect the delicate cells from intense solar radiation, especially during the summer months. Warmer, whitish areas of the ponds contain stringy masses of nonphotosynthetic eubacteria. Thermus aquaticus survives in temperatures too high for photosynthetic bacteria, up to 80^o C (176^o F). Thermus aquaticus is heterotrophic and survives on minute amounts of organic matter in the water. TAQ polymerase used in the amplification of DNA using the polymerase chain reaction (PCR) was originally isolated from a colony of T. aquaticus collected in a hot spring at Yellowstone National Park.

Archaebacteria thrive in boiling water at Yellowstone National Park, at temperatures of 92^o C (198^o F). These bacteria also thrive near steam vents at the bottom of the ocean at temperatures exceeding 115^o C (239^o F). Scientists from throughout the world are studying the amazing bacteria flora at Yellowstone National Park. This is one of the best places on earth to study these organisms in their natural protected habitats. In other parts of the world, similar hot springs have been destoyed for the production of geothermal energy.

Acid hot springs in Yellowstone National Park with a pH of below 4.0 support the eukaryotic alga Cyanidium caldarum. This remarkable photosynthetic alga can even survive in a pH of zero! Some acidophilic hot springs bacteria utilize the oxidation of sulfur and iron for the synthesis of ATP. Alkaline hot springs support colonies of bacteria that utilize hydrogen sulfide for their energy source.

Life as we know it may have first arisen more than three billion years ago in a high temperature environment of boiling water. Thermophilic bacteria in hot springs of Yellowstone National Park may be relict populations of the first life on earth. In fact, these thermophilic bacteria may be the ancestors of all other life forms, including humans!

Now the mixture is once again heated to 95^o C and the double-stranded DNA molecules containing the target genes separate into single strands. But now there are four single strands from two double-stranded genes. The mixture is once again cooled to 52-54^o C and the primers anneal to the strands at start positions before each gene. DNA polymerase once again catalyzes the rebuilding of each single strand into four complete double-stranded genes. PCR is called polymerase chain reaction because the reaction occurs repeatedly in cycles as duplicate copies of genes are produced exponentially. After only 40 cycles there would be 1.0995116 X 10¹² or more than one trillion copies of the original gene!

One of the most novel uses for DNA sequencing is the determination of when humans first began wearing clothing. According to Mark Stoneking and his colleagues at the Max Planck Institiute for Evolutionary Anthropology in Leipzig, Germany, we started wearing clothing about 70,000 years ago. This date is based on genes of human sucking lice. It correlates with the approximate time when the body louse evolved from the human head louse and corresponds to the time when the body louse's habitat (clothing) became widespread. This is also the time when Homo sapiens sapiens began moving out of Africa into cooler regions of Europe.

Human head louse

Sucking lice belong to the wingless, parasitic insect order Anoplura. Human sucking lice include body lice, crab lice and head lice (Pediculus humanus). Anoplurans use a set of long hypodermic-like stylets to pierce the skin and withdraw blood. After ingesting blood their body becomes swollen and shows a dark clot of blood in their abdomen. There are two forms of human sucking lice, the head louse (P. humanus capitis) and the body louse (P. humanus humanus). The head louse infests the hair of the scalp and the body louse lives in clothing near the body surface. Human lice are also known as "cooties" and their eggs attached to hairs are called "nits." Human lice cause local itching, but the discomfort is minor compared with the misery of the bacterium they can transmit called Rickettsia prowazeki. This minute bacterium causes "Epidemic Typhus," a serious disease that has devastated populations in medieval Europe.

Stoneking and his colleagues Ralf Kittler and Manfred Kayser compared mitochondrial DNA sequences from head and body lice. The greater the difference in sequences between the two forms of lice, the older their evolutionary split. Human lice from Africa are more genetically diverse than lice from other parts of the world, indicating that the species originated in Africa. Head lice are more diverse than body lice, showing that they are the older group. By comparing the mitochondrial DNA of body lice to chimpanzee lice, Stoneking's team was able to approximate the origin of body lice to around 70,000 years ago. This date correlates well with the growing evidence that modern humans evolved in Africa and migrated northward around 100,000 years ago.

Stoneking is also studying human crab lice (Pthirus pubus) which typically inhabit pubic hair. Human pubic lice are more closely related to gorilla lice than to head lice. Since this sucking louse only inhabits hairy places on the body, it might shed some light on when humans lost their heavy body hair. Crab lice are typically transferred from person to person through sexual intercourse, although they may also be picked up from infested linen, clothing and other sources.

Return To The Biology 100 DNA Lab Return To The Biology 100 Home Page Return To WAYNE'S WORD Home Page Return To NOTEWORTHY PLANTS Page Go To Biology GEE WHIZ TRIVIA Page Go To The LEMNACEAE ON-LINE Page